Applied biosystems geneamp 5700 23427 in burladingen, germany. Cmv tm pcr kit may neither be used in combination with the. Perkin elmer abi geneamp 9600 5700 real time pcr with 5700 sequence detection system is a system for realtime quantitative pcr. Sybr green pcr master mix and rtpcr reagents protocol. Colorimetric detection of hepatitis e virus based on reverse. Geneamp 5700 sequence detection system sds software. The electrical supply 4 electrical outlets should have a dedicated 2. Rapid detection and quantification of members of the archaeal.
Research article open access the common rs9939609 variant of. Fully loaded, the instrument accommodates up to 192 samples per run. We have also performed pcr amplification and melting analysis in a 96well format on the cheaper thermal cyclers, abi geneamp 5700 and abi prism 7000 sequence detection systems applied. C t values threshold cycle represent the pcr cycle in which an increase in fluorescence, over a defined threshold, first occurred, for each. The abi 5700 with the geneamp 5700 sds software, version 1.
Truescience respifinder pathogen identification panels. Print bookmark share pdf 337kb english format file size. Circannual changes in the expression of vascular endothelial. Sybr green pcr master mix thermo fisher scientific. Age and sexdependent association between fto rs9939609 and. It is a less table 1 realtime pcr instruments max sample company pcr system sample format number applied biosystems abi prism 7700 sds microplate 96. Taqman onestep rtpcr master mix reagents kit protocol pn. Short interfering rna sirna smartpool sequences were. Highthroughput snp genotyping by singletube pcr with tm.
The 5700 system has single wavelength color detection fam or sybr and includes a 9600 thermal cycler. Geneamp pcr system 2700 thermo fisher scientific us. For use with the prism 7000abi 7700, and 7900ht sequence detection systemsfor the quantitative detection of cmv dna from edta plasma. Description applied biosystems abi geneamp pcr system. The genotype was determined from the ct values obtained with the geneamp 5700 sds software. The electrical receptacle must be located within 1.
Sequence detection systems abi prism 7900ht, 7000, 7700. Everything you need for sybr green dyebased pcr amplification and detection in a convenient, singletube format. The small footprint means that this device makes good use of available bench space. Evaluation of universal probes and primer sets for. Perkin elmer geneamp 9600, abi prism 310 repair help showing 1 of messages. For use with equipment 2720 thermal cycler, 3xl genetic analyzer, 3500xl dx genetic analyzer, 3730xl dna. The threshold value ct was defined as 01 on the log scale and fluorescence values from cycles six. Primer express software for primer design applied biosystems reagents applied biosystems universal thermal cycling conditions about this protocol. Data acquisition and subsequent analysis were performed with abi prism 7000 sds software applied biosystems. View and download applied biosystems geneamp pcr system 9700 user manual online. Analysis of liver trx1trxr1 sacylation acylbiotin exchange assay 17 was used with slight modi.
Twostep thermal cycling was performed by using the geneamp 9600 pcr system perkinelmer, foster city, calif. Pdf simultaneous detection of the main black aspergilli. Pcr was carried out on a geneamp 5700 sequence detector with an enzyme heatactivation step of 12 min at 95c, followed by 45 cycles of twostep amplification 30 seconds at 95c, 30 seconds at 58c and an onboard dissociation run from 60c to 95c. Applied biosystems microamp optical 96well reaction plate. Please contact us if you have any questions 9196071733. The 96well geneamp pcr system 9700 contains two sample blocks, each of which holds a maximum of 96 sample wells. Applied biosystems geneamp 5700 sequence detection system w 5700 power supply. Powers on, software runs os 9 edition, diagnostics point towards a laser problem. Quantitative realtime pcr using taqman and sybr green for. Measured values were analysed using the system integrated geneamp 5700 sds software abi.
The abi geneamp pcr system 9700 is a flexible high throughput thermal cycler. Evaluation of universal probes and primer sets for assessing total bacterial load in clinical samples. Allow the computer to complete the bootup sequence. Highfat dietinduced changes in liver thioredoxin and.
Triad perkin elmer abi geneamp 9600 5700 real time pcr. Evaluation of universal probes and primer sets for assessing. The abi geneamp system 2700 is a simple, inexpensive, thermal cycler with a small footprint. Age and sexdependent association between fto rs9939609. The cells were transfected with25nmoll sirnaprkaa2,sirnaprkab1,sirna. Sybr green pcr master mix and rtpcr reagents protocol pn.
Products for abi geneamp 5700, abi prism sds 7000, 7300, 7700, 7900 the qpcr mastermixes and core kits for probe and sybr green i containing rox passive reference, have been specially optimized for the use on the abi geneamp 5700, abi prism sds 7000, 7300, 7700, 7900, stepone and mastercycler ep realplex. Applied biosystems geneamp 5700 sequence detection system. The genotype was determined from the ct values obtained with the geneamp 5700 sds. The proteasome inhibitor ps341 overcomes trail resistance in bax and caspase 9negative or bclxl overexpressing cells. The qpcr mastermixes and core kits for probe and sybr green i containing rox passive reference, have been specially optimized for the use on the abi geneamp 5700, abi prism sds 7000, 7300, 7700, 7900, stepone and mastercycler ep realplex. Abi geneamp pcr system 2700 with manual call enterprises. Short interfering rna sirna smartpool sequences were obtained from dharmaconthermo fisher scienti. Tnas were performed with a volume of 25 l, containing 12.
Please contact us if you have any questions 9196071733 jeff. The artus cmv tm pcr kit may neither be used in combination with the geneamp 5700 sds nor with the 384 plate format of the abi prism 7900ht sds. In the current study, we used the geneamp sequence detection system with taqman and. Simultaneous detection of the main black aspergilli responsible for ota contamination in grapes by multiplex realtime pcr. Results were analyzed using geneamp 5700 sds software perkin elmer applied biosystems. Please refer to the abi prism 7900ht sequence detection system and sds enterprise database user guide, the abi prism 7000 sequence detection system user guide, the abi prism 7700 sequence detection system users manual, the geneamp 5700 sequence detection system users manual. The 5700 sds differs from the 7700 sds in system, diminishing the chances of contamination.
Consisting of dna cycler 9600 and sequence detector 5700. The data were analyzed by geneamp 5700 sds software. We have also performed pcr amplification and melting analysis in a 96well format on the cheaper thermal cyclers, abi geneamp 5700 and abi prism 7000 sequence detection systems applied biosystems with comparable results data not shown. Four hev positive specimens and four hev negative specimens were analyzed by rtpcr fig. Perkin elmer geneamp 9600, abi prism 310 repair help. Normalization procedures and analyses were carried out with. Rapid detection and quantification of members of the. The primers in the neomycin gene were tgctcctgccgagaaagtatc and gccggatcaagcgtatgc.
Item is used and is untested other than what is indicated below. The 5700 system has single wavelength color detection fam or sybr. A new realtime pcr procedure was developed for the specific detection and quantification of leuconostoc mesenteroides in meat products. Abi prism 7700 sequence detection system sds, the abi prism 7900ht sds, the abi prism 7000 sds, or the geneamp 5700 sds. Reaction mixtures for the fluorogenic pcr were prepared in which the concentrations of each primer and the taqman probe were optimized 0.
View online or download applied biosystems 7500 fast installation and maintenance manual, getting started. Applied biosystems sybr green pcr master mix combines sybr green i dye, amplitaq. Interchangeable well blocks give your lab a modular solution to your application needs. For use with equipment 2720 thermal cycler, 3xl genetic analyzer, 3500xl dx genetic analyzer, 3730xl dna analyzer, 6100 nucleic acid prepstation, 6100 thermal cycler, 7000 system, 7300 system, 7500 system, 7900ht system, geneamp 9700, quantstudio, simpliamp thermal cycler, veriti dx thermal cycler. For the best quantitation results, use the following. The genotype was determined from the cycle threshold ct values obtained with the geneamp 5700 sds software.
Sybr green pcr master mix and rtpcr yale school of. The small footprint means that this device makes good use of available bench space, allowing this device to fit into any laboratory it will even fit easily on the researchers personal work bench. Abi prism 7000, 7700, 7900ht, abi 7300 qpcr systems, geneamp 5700, stepone, and the steponeplus hsm400. Eurogentec products for abi geneamp 5700, abi prism sds. Pcr results were given as the increase in the fluorescence signal of the reporter dye detected and visualized by the geneamp 5700 sds software provided with the geneamp 5700 sds applied biosystems. Pcr and fluorescence signal monitoring were performed with the geneamp 5700 sequence detection system pe applied biosystems. Applied biosystems geneamp pcr system 9700 user manual pdf.
In combination with eurogentec primers and probes it gives highly specific and sensitive results. M, respectively and the concentration of the rdna template was. Abi prism and its design, applied biosystems, and microamp are registered trademarks of applera corporation or its subsidiaries in the u. This pcr thermal cycler has exceptional heating and cooling uniformity for high quality results, in a very small space. International buyers must arrange for their own shipping. General implications and practical use in endodontic antimicrobial therapy.
Amperase, amplitaq gold, geneamp, and taqman are registered trademarks of roche. Do not launch the geneamp 5700 sds software at this time. Pcr results were given as the increase in the fluorescence signal of the reporter dye detected and visualized by the geneamp 5700 sds software provided with the geneamp 5700 sds applied. The proteasome inhibitor ps341 overcomes trail resistance. The reaction was performed using the abi prism 7000 sequence detection system foster city, ca. Applied biosystems 7900ht fast realtime pcr system thermo. Optimized for use with amplitaq dna polymerase, offering maximum pcr performance available in several convenient sizesgeneamp 10x pcr buffer i contains 15 mm mgcl2.
Applied biosystems geneamp 10x pcr buffer i is optimized for use with amplitaq dna polymerase, resulting in robust pcr amplification. Abi 7500 qpcr systems, viia 7, quantstudio 12k flex, agilent mx3000p mx3005p and mx4000 hsm400lr. The system can also be used with a single 96well plate for smaller runs. Applied biosystems 7900ht fast realtime pcr system and sds. Products for abi geneamp 5700, abi prism sds 7000, 7300. Sybr green pcr master mix pe applied biosystems, 20 pmol of.
Absence of primer dimers was controlled for by postpcr melting curve analysis according to the manufacturers recommendations abi. Geneamp pcr system 9700 laboratory equipment pdf manual download. Therefore, no adjustment is required when using the optical adhesive cover on this system. Aug 19, 2004 the abi geneamp system 2700 is a simple, inexpensive, thermal cycler with a small footprint. User bulletin abi prism 7700 and geneamp 5700 sequence. Geneamp 5700 sequence detection system users the 5700 sequence detection system automatically optimizes the ccd camera exposure time throughout a realtime pcr run.
721 7 936 473 1062 536 188 1271 577 1462 853 1331 582 128 1158 790 619 433 957 1439 1434 1177 1197 127 36 286 1190 487 733 153 158 1486 941 1162 25 422